CCL3L1 ELISA Kits Search Results


91
Multi Sciences (Lianke) Biotech Co Ltd macrophage inflammatory protein 1 alpha mip 1α elisa kit
Macrophage Inflammatory Protein 1 Alpha Mip 1α Elisa Kit, supplied by Multi Sciences (Lianke) Biotech Co Ltd, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/macrophage inflammatory protein 1 alpha mip 1α elisa kit/product/Multi Sciences (Lianke) Biotech Co Ltd
Average 91 stars, based on 1 article reviews
macrophage inflammatory protein 1 alpha mip 1α elisa kit - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

94
Bio-Techne corporation human ccl3/mip-1 alpha duoset elisa
Human Ccl3/Mip 1 Alpha Duoset Elisa, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human ccl3/mip-1 alpha duoset elisa/product/Bio-Techne corporation
Average 94 stars, based on 1 article reviews
human ccl3/mip-1 alpha duoset elisa - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

90
ELK Biotechnology mouse mip1a (macrophage inflammatory protein 1 alpha) elisa kit elk biotechnology
Mouse Mip1a (Macrophage Inflammatory Protein 1 Alpha) Elisa Kit Elk Biotechnology, supplied by ELK Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse mip1a (macrophage inflammatory protein 1 alpha) elisa kit elk biotechnology/product/ELK Biotechnology
Average 90 stars, based on 1 article reviews
mouse mip1a (macrophage inflammatory protein 1 alpha) elisa kit elk biotechnology - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

94
Elabscience Biotechnology mouse mip 1α
Mouse Mip 1α, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse mip 1α/product/Elabscience Biotechnology
Average 94 stars, based on 1 article reviews
mouse mip 1α - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

90
R&D Systems mouse ccl3 detection kit
Figure 3 | Protein S (PROS1)-deficient macrophages display reduced reprogramming. Macrophages from Pros1fl/fl or LysMCre/+; Pros1fl/fl mice were isolated from peritoneal exudates 66 h after zymosan A injection and incubated for 24 h with vehicle or lipopolysaccharide (LPS, 1 µg/ml). Then, supernatants were collected and analyzed for their content of TNFα [(A), **P = 0.003], IL-6 (B), <t>CCL3</t> [(C), *P = 0.02], and IL-10 [(D); *P ≤ 0.03] by standard ELISA. (E) IL-10 secretion by untreated or LPS-stimulated control and Pros1-cKO peritoneal macrophages, or by macrophages supplemented with either PROS1 (25 nM), apoptotic cells (AC) or both (AC + PROS1). Results represent the means ± SEM of at least three independent experiments. Two-way ANOVA, *P = 0.02, ***P ≤ 0.0001.
Mouse Ccl3 Detection Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ccl3 detection kit/product/R&D Systems
Average 90 stars, based on 1 article reviews
mouse ccl3 detection kit - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
PeproTech human mip-1alpha (ccl3) elisa kit
Glutamine and pyruvate supplementation reduces proinflammatory cytokines and chemokines production in macrophages (A) Violin plot shows glutamine levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (B) Violin plots shows expression levels of SLC1A5 , GLS , and GLUD1 in macrophages from BALF of patients with HCs, mild or COVID-19. (C) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (D) GSEA analysis of pyruvate metabolism gene sets in macrophages from patients with severe versus mild COVID-19 . (E) Expression levels of PDHA1 (pyruvate dehydrogenase E1 subunit alpha 1) , PDHB (pyruvate dehydrogenase E1 subunit beta) , and LDHB (lactate dehydrogenase B) in macrophages from BALF of patients with HCs, mild, or severe COVID-19. (F) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (G–I) Human primary monocyte-derived macrophages were stimulated with SARS-CoV-2 virus (MOI = 0.1) for 24 h (G). mRNA levels of SLC1A5 , GLUD1 , and GLUL (H) and PDHA1 , PDHB , and LDHB (I) were detected by real-time PCR. Shown are representative data (mock, n = 5; SARS-CoV-2, n = 5) from 3 independent donors with mean values. (J–L) Human primary macrophages cultured in complete medium or medium without glutamine and pyruvate were stimulated with SARS-CoV-2 (J). CCL2 and TFN-α levels in culture supernatant were detected by enzyme-linked immunosorbent assay(ELISA), and <t>CCL3</t> and IL1B in cells were detected by real-time PCR 24 h after stimulation(K-L). (M) Violin plot shows glucose levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (N–P) Human primary macrophages cultured in complete medium with 2-DG were stimulated with SARS-CoV-2 (N). CCL2 and CCL3 levels in culture supernatant were detected by ELISA, and IL6 and IL1B in cells were detected by real-time PCR 24 h after stimulation (O-P). Shown are representative data (n = 6 for each group) from 3 independent donors with mean values. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Unpaired, two-tailed Student’s t test (for H and I) or one-way ANOVA and Bonferroni’s post hoc test (for K-L and O-P) were performed to compare between groups.
Human Mip 1alpha (Ccl3) Elisa Kit, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human mip-1alpha (ccl3) elisa kit/product/PeproTech
Average 90 stars, based on 1 article reviews
human mip-1alpha (ccl3) elisa kit - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
ELK Biotechnology mouse mip1α (macrophage inflammatory protein 1 alpha) elisa kit

Mouse Mip1α (Macrophage Inflammatory Protein 1 Alpha) Elisa Kit, supplied by ELK Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse mip1α (macrophage inflammatory protein 1 alpha) elisa kit/product/ELK Biotechnology
Average 90 stars, based on 1 article reviews
mouse mip1α (macrophage inflammatory protein 1 alpha) elisa kit - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
PeproTech ccl2 chemokine
Determination of chemokines involved in monocyte chemoattraction. a The expression of different members of the monocyte chemoattractant protein family was evaluated by qPCR. Results are first normalised to the mean expression of two housekeeping genes (GAPDH and HPRT1) and then toward gold standard DC. The relative expression of nine different donor is represented as mean ± SE. *p < 0.05, ns p > 0.05 in the Tukey post hoc test. b The <t>CCL2</t> and CCL8 concentration of “wash out” supernatants from mature DC seeded in the absence of exogenous stimuli for 24 h were determined by sandwich ELISA. The results are represented as mean ± SE of 8–12 different donors. *p < 0.05, ns p > 0.05 in the Tukey post hoc test.
Ccl2 Chemokine, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccl2 chemokine/product/PeproTech
Average 90 stars, based on 1 article reviews
ccl2 chemokine - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Becton Dickinson cba multiplexing kit
Determination of chemokines involved in monocyte chemoattraction. a The expression of different members of the monocyte chemoattractant protein family was evaluated by qPCR. Results are first normalised to the mean expression of two housekeeping genes (GAPDH and HPRT1) and then toward gold standard DC. The relative expression of nine different donor is represented as mean ± SE. *p < 0.05, ns p > 0.05 in the Tukey post hoc test. b The <t>CCL2</t> and CCL8 concentration of “wash out” supernatants from mature DC seeded in the absence of exogenous stimuli for 24 h were determined by sandwich ELISA. The results are represented as mean ± SE of 8–12 different donors. *p < 0.05, ns p > 0.05 in the Tukey post hoc test.
Cba Multiplexing Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cba multiplexing kit/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
cba multiplexing kit - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier


N/A
Human CCL3L1/LD78 beta ELISA Kit (Colorimetric)
  Buy from Supplier

N/A
Mouse CCL3L1/LD78 beta ELISA Kit (Colorimetric)
  Buy from Supplier

Image Search Results


Figure 3 | Protein S (PROS1)-deficient macrophages display reduced reprogramming. Macrophages from Pros1fl/fl or LysMCre/+; Pros1fl/fl mice were isolated from peritoneal exudates 66 h after zymosan A injection and incubated for 24 h with vehicle or lipopolysaccharide (LPS, 1 µg/ml). Then, supernatants were collected and analyzed for their content of TNFα [(A), **P = 0.003], IL-6 (B), CCL3 [(C), *P = 0.02], and IL-10 [(D); *P ≤ 0.03] by standard ELISA. (E) IL-10 secretion by untreated or LPS-stimulated control and Pros1-cKO peritoneal macrophages, or by macrophages supplemented with either PROS1 (25 nM), apoptotic cells (AC) or both (AC + PROS1). Results represent the means ± SEM of at least three independent experiments. Two-way ANOVA, *P = 0.02, ***P ≤ 0.0001.

Journal: Frontiers in immunology

Article Title: Macrophage-Derived Protein S Facilitates Apoptotic Polymorphonuclear Cell Clearance by Resolution Phase Macrophages and Supports Their Reprogramming.

doi: 10.3389/fimmu.2018.00358

Figure Lengend Snippet: Figure 3 | Protein S (PROS1)-deficient macrophages display reduced reprogramming. Macrophages from Pros1fl/fl or LysMCre/+; Pros1fl/fl mice were isolated from peritoneal exudates 66 h after zymosan A injection and incubated for 24 h with vehicle or lipopolysaccharide (LPS, 1 µg/ml). Then, supernatants were collected and analyzed for their content of TNFα [(A), **P = 0.003], IL-6 (B), CCL3 [(C), *P = 0.02], and IL-10 [(D); *P ≤ 0.03] by standard ELISA. (E) IL-10 secretion by untreated or LPS-stimulated control and Pros1-cKO peritoneal macrophages, or by macrophages supplemented with either PROS1 (25 nM), apoptotic cells (AC) or both (AC + PROS1). Results represent the means ± SEM of at least three independent experiments. Two-way ANOVA, *P = 0.02, ***P ≤ 0.0001.

Article Snippet: reagents ELISA kits for mouse TNFα, IL-10, and IL-6 were obtained from Biolegend; a mouse CCL3 detection kit was obtained from R&D Systems.

Techniques: Isolation, Injection, Incubation, Enzyme-linked Immunosorbent Assay, Control

Glutamine and pyruvate supplementation reduces proinflammatory cytokines and chemokines production in macrophages (A) Violin plot shows glutamine levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (B) Violin plots shows expression levels of SLC1A5 , GLS , and GLUD1 in macrophages from BALF of patients with HCs, mild or COVID-19. (C) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (D) GSEA analysis of pyruvate metabolism gene sets in macrophages from patients with severe versus mild COVID-19 . (E) Expression levels of PDHA1 (pyruvate dehydrogenase E1 subunit alpha 1) , PDHB (pyruvate dehydrogenase E1 subunit beta) , and LDHB (lactate dehydrogenase B) in macrophages from BALF of patients with HCs, mild, or severe COVID-19. (F) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (G–I) Human primary monocyte-derived macrophages were stimulated with SARS-CoV-2 virus (MOI = 0.1) for 24 h (G). mRNA levels of SLC1A5 , GLUD1 , and GLUL (H) and PDHA1 , PDHB , and LDHB (I) were detected by real-time PCR. Shown are representative data (mock, n = 5; SARS-CoV-2, n = 5) from 3 independent donors with mean values. (J–L) Human primary macrophages cultured in complete medium or medium without glutamine and pyruvate were stimulated with SARS-CoV-2 (J). CCL2 and TFN-α levels in culture supernatant were detected by enzyme-linked immunosorbent assay(ELISA), and CCL3 and IL1B in cells were detected by real-time PCR 24 h after stimulation(K-L). (M) Violin plot shows glucose levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (N–P) Human primary macrophages cultured in complete medium with 2-DG were stimulated with SARS-CoV-2 (N). CCL2 and CCL3 levels in culture supernatant were detected by ELISA, and IL6 and IL1B in cells were detected by real-time PCR 24 h after stimulation (O-P). Shown are representative data (n = 6 for each group) from 3 independent donors with mean values. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Unpaired, two-tailed Student’s t test (for H and I) or one-way ANOVA and Bonferroni’s post hoc test (for K-L and O-P) were performed to compare between groups.

Journal: iScience

Article Title: Metabolic modeling of single bronchoalveolar macrophages reveals regulators of hyperinflammation in COVID-19

doi: 10.1016/j.isci.2022.105319

Figure Lengend Snippet: Glutamine and pyruvate supplementation reduces proinflammatory cytokines and chemokines production in macrophages (A) Violin plot shows glutamine levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (B) Violin plots shows expression levels of SLC1A5 , GLS , and GLUD1 in macrophages from BALF of patients with HCs, mild or COVID-19. (C) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (D) GSEA analysis of pyruvate metabolism gene sets in macrophages from patients with severe versus mild COVID-19 . (E) Expression levels of PDHA1 (pyruvate dehydrogenase E1 subunit alpha 1) , PDHB (pyruvate dehydrogenase E1 subunit beta) , and LDHB (lactate dehydrogenase B) in macrophages from BALF of patients with HCs, mild, or severe COVID-19. (F) Violin plots show relative levels of indicated metabolic fluxes in macrophages from patients with mild and severe COVID-19. (G–I) Human primary monocyte-derived macrophages were stimulated with SARS-CoV-2 virus (MOI = 0.1) for 24 h (G). mRNA levels of SLC1A5 , GLUD1 , and GLUL (H) and PDHA1 , PDHB , and LDHB (I) were detected by real-time PCR. Shown are representative data (mock, n = 5; SARS-CoV-2, n = 5) from 3 independent donors with mean values. (J–L) Human primary macrophages cultured in complete medium or medium without glutamine and pyruvate were stimulated with SARS-CoV-2 (J). CCL2 and TFN-α levels in culture supernatant were detected by enzyme-linked immunosorbent assay(ELISA), and CCL3 and IL1B in cells were detected by real-time PCR 24 h after stimulation(K-L). (M) Violin plot shows glucose levels in plasma of HCs or patients with COVID-19. Each dot corresponds to an individual patient. (N–P) Human primary macrophages cultured in complete medium with 2-DG were stimulated with SARS-CoV-2 (N). CCL2 and CCL3 levels in culture supernatant were detected by ELISA, and IL6 and IL1B in cells were detected by real-time PCR 24 h after stimulation (O-P). Shown are representative data (n = 6 for each group) from 3 independent donors with mean values. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Unpaired, two-tailed Student’s t test (for H and I) or one-way ANOVA and Bonferroni’s post hoc test (for K-L and O-P) were performed to compare between groups.

Article Snippet: Human MIP-1alpha (CCL3) ELISA Kit , Peprotech , Cat# 900-K35.

Techniques: Clinical Proteomics, Expressing, Derivative Assay, Virus, Real-time Polymerase Chain Reaction, Cell Culture, Enzyme-linked Immunosorbent Assay, Two Tailed Test

Journal: iScience

Article Title: Metabolic modeling of single bronchoalveolar macrophages reveals regulators of hyperinflammation in COVID-19

doi: 10.1016/j.isci.2022.105319

Figure Lengend Snippet:

Article Snippet: Human MIP-1alpha (CCL3) ELISA Kit , Peprotech , Cat# 900-K35.

Techniques: Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Software, Activity Assay

Journal: iScience

Article Title: Behenic acid alleviates inflammation and insulin resistance in gestational diabetes mellitus by regulating TLR4/NF-κB signaling pathway

doi: 10.1016/j.isci.2024.111019

Figure Lengend Snippet:

Article Snippet: Mouse MIP1α (Macrophage Inflammatory Protein 1 Alpha) ELISA Kit , ELK Biotechnology, China , Cat#ELK1116.

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, RNA Extraction, SYBR Green Assay, CCK-8 Assay, Software

Determination of chemokines involved in monocyte chemoattraction. a The expression of different members of the monocyte chemoattractant protein family was evaluated by qPCR. Results are first normalised to the mean expression of two housekeeping genes (GAPDH and HPRT1) and then toward gold standard DC. The relative expression of nine different donor is represented as mean ± SE. *p < 0.05, ns p > 0.05 in the Tukey post hoc test. b The CCL2 and CCL8 concentration of “wash out” supernatants from mature DC seeded in the absence of exogenous stimuli for 24 h were determined by sandwich ELISA. The results are represented as mean ± SE of 8–12 different donors. *p < 0.05, ns p > 0.05 in the Tukey post hoc test.

Journal: Journal of Translational Medicine

Article Title: Different maturation cocktails provide dendritic cells with different chemoattractive properties

doi: 10.1186/s12967-015-0528-7

Figure Lengend Snippet: Determination of chemokines involved in monocyte chemoattraction. a The expression of different members of the monocyte chemoattractant protein family was evaluated by qPCR. Results are first normalised to the mean expression of two housekeeping genes (GAPDH and HPRT1) and then toward gold standard DC. The relative expression of nine different donor is represented as mean ± SE. *p < 0.05, ns p > 0.05 in the Tukey post hoc test. b The CCL2 and CCL8 concentration of “wash out” supernatants from mature DC seeded in the absence of exogenous stimuli for 24 h were determined by sandwich ELISA. The results are represented as mean ± SE of 8–12 different donors. *p < 0.05, ns p > 0.05 in the Tukey post hoc test.

Article Snippet: Following primers were used: GAPDH (GAGAAGGCTGGGGCTCATTTGC, GGACTGTGGTCATGAGTCCTTCC), HPRT1 (GCTGGATTACATCAAAGCACTG, CTGACCAAGGAAAGCAAAGTCT), CCL2 (CCCCAGTCACCTGCTGTTAT, TGGAATCCTGAACCCACTTC), CCL3L (CTCTGCAACCAGGTCCTCTC, TTTCTGGACCCACTCCTCAC: amplify CCL3L1 and CCL3L3, but not CCL3), CCL4 (TACCATGAAGCTCTGCGTGA, TACCACAAAGTTGCGAGGAA; amplify CCL4, CLL4L1 and CCL4L2), CCL5 (CGCTGTCATCCTCATTGCTA, ACACACTTGGCGGTTCTTTC), CCL8 (CCCTCCAAGATGAAGGTTTC, GAATCCCTGACCCATCTCTC), CCL13 (TGCACTCAACGTCCCATCTA, ACTTCTCCTTTGGGTCAGCA), CCL17 (TTCAAAACCAGGGTGTCTCC, CTGCCCTGCACAGTTACAAA), CCL22 (ACTGCACTCCTGGTTGTCCT, GCTCTTCATTGGCTCAGCTT), CCL23 (TTTGAAACGAACAGCGAGTG, TGTGTCCCTTCACCTTGACA), CXCL8 (TTGCCAAGGAGTGCTAAAGAA, CAGACAGAGCTCTCTTCCATCA), CXCL9 (TGCTGGTTCTGATTGGAGTG, TTTGGCTGACCTGTTTCTCC), CXCL10 (CAACACGTGGACAAAATTGG, TCCAGTCTCAGCACCATGAA), CXCL11 (AGAGGACGCTGTCTTTGCAT, TAAGCCTTGCTTGCTTCGAT), CXCL16 (CTCCTGGCCATCATCTTCAT, AAGCTTCCATTCTTGGCTCA), The chemokine concentrations in the DC “wash out” supernatants were determined by sandwich ELISA for CCL2, CCL3, CCL5, CCL8, CXCL9 and CXCL16 (all from PeproTech) and by flow cytometric plexing for CCL4/MIP-1β, CXCL8/IL8 and CXCL10/IP-10 (CBA multiplexing kit, Becton–Dickinson).

Techniques: Expressing, Concentration Assay, Sandwich ELISA